View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18772_low_13 (Length: 308)

Name: NF18772_low_13
Description: NF18772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18772_low_13
NF18772_low_13
[»] chr8 (3 HSPs)
chr8 (59-129)||(43017057-43017127)
chr8 (201-252)||(43017130-43017181)
chr8 (263-292)||(43017200-43017229)


Alignment Details
Target: chr8 (Bit Score: 67; Significance: 9e-30; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 59 - 129
Target Start/End: Original strand, 43017057 - 43017127
Alignment:
59 tgacattgtggttgtagaatcctcaatatacttgatgtgagacctgaatcgttgtgatagatccttaaaaa 129  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
43017057 tgacattgtggttgtagaatcatcaatatacttgatgtgagacctgaatcgttgtgatagatccttaaaaa 43017127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 201 - 252
Target Start/End: Original strand, 43017130 - 43017181
Alignment:
201 gaactacttttactccatgatttctttaaattcacaacctgttctttccagt 252  Q
    |||||| ||||||| |||||||||||||||||||||||||||||||||||||    
43017130 gaactatttttacttcatgatttctttaaattcacaacctgttctttccagt 43017181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 263 - 292
Target Start/End: Original strand, 43017200 - 43017229
Alignment:
263 tagtatttgttcggttttgttcatttacaa 292  Q
    ||||||||||||||||||||||||||||||    
43017200 tagtatttgttcggttttgttcatttacaa 43017229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University