View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18772_low_17 (Length: 242)
Name: NF18772_low_17
Description: NF18772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18772_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 10 - 223
Target Start/End: Complemental strand, 3022851 - 3022634
Alignment:
| Q |
10 |
agtagcaaaggaaacatgtaaactatattttgcgtactttgttctagcccagagtgttgttta----cttattatctcgaaataattttagctaaaactt |
105 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3022851 |
agtatcaaaggaaacgtgtaaactatattttgcgtactttgttctagcccagagtgttgtttaattacttattatctcgaaataattttagctaaaactt |
3022752 |
T |
 |
| Q |
106 |
actcaaattgctcttgattcttttggaccttgaatcacccatttcaagtgatgatatggaccatctttcctcaaaataagactcttgaacttttcaacag |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3022751 |
actcaaattgctcttgattcttttggaccttgaatcacccatttcaagtgatgatatggaccatctttcctcaaaataagactcttgaacttttcaatag |
3022652 |
T |
 |
| Q |
206 |
cttaatcgtcttaaactt |
223 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3022651 |
cttaatcgtcttaaactt |
3022634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University