View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18773_low_16 (Length: 266)
Name: NF18773_low_16
Description: NF18773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18773_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 2308039 - 2307789
Alignment:
| Q |
1 |
aatggcatcatagtaactgtgcacctcaattgatgcctgatcctatccaggttgttaaagaatttgaaagttgcagtgagatggtgtcaacctcacaagt |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2308039 |
aatggcatcatagtgactgtgcacctcaattgatgcctgatcctatccaggttgttaaagaatttgaaagttgcagtgagatggtgtcaacctcacaagt |
2307940 |
T |
 |
| Q |
101 |
aaattcagagaatatcccacaagatggctctgaggtaatcaannnnnnncagctttattgcagttctctgaaggaatatgtgaacttttgtgtagatttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2307939 |
aaattcagagaatatcccacaagatggctctgaggtaatcaatttttttcaggtttattgcagttctctgaaggaatatgtgaacttttgtgtagatttt |
2307840 |
T |
 |
| Q |
201 |
gcagtctttactgctttcccccctctctgaatgattttgtttatgtctgtg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2307839 |
gcagtctttactgctttcccccctctctgaatgattttgtttatgtctgtg |
2307789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 4 - 251
Target Start/End: Complemental strand, 2317237 - 2316990
Alignment:
| Q |
4 |
ggcatcatagtaactgtgcacctcaattgatgcctgatcctatccaggttgttaaagaatttgaaagttgcagtgagatggtgtcaacctcacaagtaaa |
103 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2317237 |
ggcatcatagtgactgtgcacctcaattgatgcctgatcctatccaggtagttaaagaagttgaaaattgcagtgagatggtgtcaacctcacaagtaaa |
2317138 |
T |
 |
| Q |
104 |
ttcagagaatatcccacaagatggctctgaggtaatcaannnnnnncagctttattgcagttctctgaaggaatatgtgaacttttgtgtagattttgca |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2317137 |
ttcagagaatatcccacaagatggctctgaggtaatcaatttttttcaggtttattgcagttctctgaaggaatatgtgaacttttgtgtagattttgcg |
2317038 |
T |
 |
| Q |
204 |
gtctttactgctttcccccctctctgaatgattttgtttatgtctgtg |
251 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2317037 |
gtcttttctgctttcccccctctctgaatgattttgtttatgtctgtg |
2316990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 5 - 53
Target Start/End: Original strand, 10494275 - 10494323
Alignment:
| Q |
5 |
gcatcatagtaactgtgcacctcaattgatgcctgatcctatccaggtt |
53 |
Q |
| |
|
|||| ||||| |||||| ||||||||||||| |||||| |||||||||| |
|
|
| T |
10494275 |
gcattatagtgactgtgtacctcaattgatgtctgatcttatccaggtt |
10494323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University