View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18775_high_15 (Length: 346)
Name: NF18775_high_15
Description: NF18775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18775_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 26 - 324
Target Start/End: Original strand, 35117196 - 35117491
Alignment:
| Q |
26 |
ttgtatttttggataactataattcattttatgctttatataacataacaaagacattgatgaatgaaatgaaacagataacatttgatgaaatggtaac |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35117196 |
ttgtatttttggataactataattcattttatgctttatataacataacaaagacattgatgaatgaaatgaaacagataacatttgatgaaatggtaac |
35117295 |
T |
|
| Q |
126 |
aaaaaacagtaaatttatgcgttttgctattgaaataacgaagatacgataatgtttacaaaactaatttcatttcatagagtatagattatacaaatca |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
35117296 |
aaaaaacagtaaatttatgcgttttgctattgaaataacgaagatacaataatgtttacaaaactaatttcatttcatagattatagattatacagatca |
35117395 |
T |
|
| Q |
226 |
agtcataaaccataattttcaatagtcaaaatttttcttcacctttggcttcttctaattttatttccttcttatcatcatcacaaagaatgtccattg |
324 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35117396 |
agtcataaaccataattttcaatagtc--agtttttctt-acctttggcttcttctaattttatttccttcttatcatcatcacaaagaatgtccattg |
35117491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University