View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18775_high_9 (Length: 416)
Name: NF18775_high_9
Description: NF18775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18775_high_9 |
 |  |
|
| [»] chr6 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 127; Significance: 2e-65; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 290 - 416
Target Start/End: Complemental strand, 30129066 - 30128940
Alignment:
| Q |
290 |
atgacaatgcataaagcaactaatccacaaaccatggatttctcatgaagtcgcttatgttcacctaaccaaaacttttaccttgtcaatcaagccttaa |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30129066 |
atgacaatgcataaagcaactaatccacaaaccatggatttctcatgaagtcgcttatgttcacctaaccaaaacttttaccttgtcaatcaagccttaa |
30128967 |
T |
 |
| Q |
390 |
tcaattgggagctacttatctatttaa |
416 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
30128966 |
tcaattgggagctacttatctatttaa |
30128940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 188 - 293
Target Start/End: Complemental strand, 30129890 - 30129785
Alignment:
| Q |
188 |
atataaatgtataattattgctgaaacctttatttaattttggttttaggaaagtaacagcagatctatttaaaaattgagtaatagtcaataataccat |
287 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
30129890 |
atataaatgtataattattgttgaaacctttatttaattttggttttaggaaagtaacagcagatctatgtaaaaattgagtaatagtcaacaataccat |
30129791 |
T |
 |
| Q |
288 |
ggatga |
293 |
Q |
| |
|
|||||| |
|
|
| T |
30129790 |
ggatga |
30129785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 147 - 180
Target Start/End: Complemental strand, 30129890 - 30129857
Alignment:
| Q |
147 |
atataaatgtataattattgttgaaacctttatt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30129890 |
atataaatgtataattattgttgaaacctttatt |
30129857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University