View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18775_low_19 (Length: 309)
Name: NF18775_low_19
Description: NF18775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18775_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 17 - 303
Target Start/End: Complemental strand, 33993070 - 33992784
Alignment:
| Q |
17 |
aagatgggctatgctaggagcactaggatgcatcacaccagaagtacttgaaaaatgggtaagagttgacttcaaagaaccagtttggttcaaagcagga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33993070 |
aagatgggctatgctaggagcactaggatgcatcacaccagaagtacttgaaaaatgggtaagagttgacttcaaagaaccagtttggttcaaagcagga |
33992971 |
T |
 |
| Q |
117 |
tcacaaatcttctcggaaggtggtcttgactatttagggaacccaaaccttgttcatgcacaaagcatcttagcagtactaggtttccaagttgttctaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33992970 |
tcacaaatcttctcggaaggtggtcttgactatttagggaacccaaaccttgttcatgcacaaagcatcttagcagtactaggtttccaagttgttctaa |
33992871 |
T |
 |
| Q |
217 |
tgggtcttgttgaaggctttcgcatcaacggtcttcctggtgtcggagagggcaacaacctctaccctggtggccaatactttgacc |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33992870 |
tgggtcttgttgaaggctttcgcatcaacggtcttcctggtgtcggagagggcaacaacctctaccctggtggccaatactttgacc |
33992784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University