View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18775_low_24 (Length: 253)
Name: NF18775_low_24
Description: NF18775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18775_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 8e-73; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 14 - 184
Target Start/End: Original strand, 11826007 - 11826177
Alignment:
| Q |
14 |
accaagaaggtatatgaaacttcaatttcatcttgtgaacaacaattatgcacttgaaacctttatcaccttagcaaggcaattgtctttgggctttggt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11826007 |
accaagaaggtatatgaaacttcaatttcctcttgtgaacaacaattatgcacttgaaacctttatcaccttagcaaggcaattgtctttgggctttggt |
11826106 |
T |
 |
| Q |
114 |
gatggtaagctagtaataggacaatttggatttactcgctccaatctatacaaaatagataaattagtaat |
184 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| || | ||| || ||||||||||||||||||| |
|
|
| T |
11826107 |
gatggtaagctagtaataggacaatctggatttactcgatcaagcctacacgaaatagataaattagtaat |
11826177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 53 - 172
Target Start/End: Original strand, 11799264 - 11799383
Alignment:
| Q |
53 |
caacaattatgcacttgaaacctttatcaccttagcaaggcaattgtctttgggctttggtgatggtaagctagtaataggacaatttggatttactcgc |
152 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| | ||||||||||||| | ||||| | | ||||||||| ||||||||| || | ||||||||||||| |
|
|
| T |
11799264 |
caacaactatgcacttgaaacctttatcaccttggaaaggcaattgtctataggcttggataatggtaagcaagtaatagggcattctggatttactcgc |
11799363 |
T |
 |
| Q |
153 |
tccaatctatacaaaataga |
172 |
Q |
| |
|
||||| ||| | |||||||| |
|
|
| T |
11799364 |
tccaacctacataaaataga |
11799383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 74 - 145
Target Start/End: Original strand, 11815194 - 11815265
Alignment:
| Q |
74 |
ctttatcaccttagcaaggcaattgtctttgggctttggtgatggtaagctagtaataggacaatttggatt |
145 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||| ||||||||||| ||| |||||||| | |||||| |
|
|
| T |
11815194 |
ctttatcaccctagcaaggcaattgtctatgggctttgatgatggtaagcaagtcataggacattctggatt |
11815265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University