View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18775_low_28 (Length: 237)
Name: NF18775_low_28
Description: NF18775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18775_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 16771837 - 16771635
Alignment:
| Q |
1 |
ttatcttcaagaaagaaagnnnnnnncagttattttataaatagtaaacaattgaattaagcttttagactaatctatgtttctacttcaaggtatgtac |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16771837 |
ttatcttcaagaaagaaagaaaaaaacagttattttctaaatagtaaacaattgaattaagcttttagactaatctatgtttctacttcaaggtatgtac |
16771738 |
T |
|
| Q |
101 |
gataaagagagccctagttgcagggccattttcagctttcacaataaaagtagaatgtacgaagctctagcttttaaccctcatgatctttgtatcctac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16771737 |
gataaagagagccctagttgcagggccattttcagctttcacaataaaagtagaatgtacgaagctctagcttttaaccctcatgatctttgtatcctac |
16771638 |
T |
|
| Q |
201 |
caa |
203 |
Q |
| |
|
||| |
|
|
| T |
16771637 |
caa |
16771635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 52 - 180
Target Start/End: Complemental strand, 16779259 - 16779138
Alignment:
| Q |
52 |
ttgaattaagcttttagactaatctatgtttctacttcaaggtatgtacgataaagagagccctagttgcagggccattttcagctttcacaataaaagt |
151 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |||| |||||||| |||||||||||||| |
|
|
| T |
16779259 |
ttgaattaagcttttagactagtctatgtttctacttaaaggtatgtacgataaagagagccctaattgctgggccatt-------ttcacaataaaagt |
16779167 |
T |
|
| Q |
152 |
agaatgtacgaagctctagcttttaaccc |
180 |
Q |
| |
|
|||||||||||| | |||||||| ||||| |
|
|
| T |
16779166 |
agaatgtacgaaacactagctttcaaccc |
16779138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University