View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18776_high_29 (Length: 320)
Name: NF18776_high_29
Description: NF18776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18776_high_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 93 - 303
Target Start/End: Original strand, 38038680 - 38038891
Alignment:
| Q |
93 |
cttaattagaatctggttcgaacttactagcttattgcatttacatcattaagtgtttttagtattttgcaacaaacatgattttactagcttattgggt |
192 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38038680 |
cttaactagaatctggttcgaacttactagcttattgcatttacatcattaagtgtttttagtattttgcaacaaacatcattttactagcttattgggt |
38038779 |
T |
 |
| Q |
193 |
attatggtataaggtaccacttttttgatgtacaatataaaaga-gaaatacagtaaaaagagactgactatgattaagcaattctgaaaactggggttt |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38038780 |
attatggtataaggtaccacttttttgatgtacaatataaaagaggaaatacagtaaaaagagactaactatgattaagcaattctgaaaactggggttt |
38038879 |
T |
 |
| Q |
292 |
atatcttgttgt |
303 |
Q |
| |
|
|||||||||||| |
|
|
| T |
38038880 |
atatcttgttgt |
38038891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 10 - 60
Target Start/End: Original strand, 38038633 - 38038683
Alignment:
| Q |
10 |
atgaaattgaaaaagaggaatataaatggccctccaatgcatatgaactta |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38038633 |
atgaaattgaaaaagaggaatataaatggccctccaatgcatatgaactta |
38038683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 155 - 219
Target Start/End: Original strand, 38025340 - 38025404
Alignment:
| Q |
155 |
tattttgcaacaaacatgattttactagcttattgggtattatggtataaggtaccacttttttg |
219 |
Q |
| |
|
||||||||||| |||| ||||||||| ||||||||||| || |||| |||||||||||||||||| |
|
|
| T |
38025340 |
tattttgcaacgaacaagattttacttgcttattgggttttgtggtgtaaggtaccacttttttg |
38025404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 155 - 219
Target Start/End: Original strand, 38030739 - 38030803
Alignment:
| Q |
155 |
tattttgcaacaaacatgattttactagcttattgggtattatggtataaggtaccacttttttg |
219 |
Q |
| |
|
||||||||||| |||| ||||||||| ||||||||||| || |||| |||||||||||||||||| |
|
|
| T |
38030739 |
tattttgcaacgaacaagattttacttgcttattgggttttgtggtgtaaggtaccacttttttg |
38030803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University