View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18776_high_41 (Length: 253)
Name: NF18776_high_41
Description: NF18776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18776_high_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 38038482 - 38038224
Alignment:
| Q |
1 |
ccagggaaaggggacacagcaagaaactgattttccctaagcaaaacctaaacaaacaaacaag--------------------attattacatttaagc |
80 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38038482 |
ccagggaaaggggacacagcaagaaagtgattttccctaagcaaaacctaaacaaacaaacaagtcagaagaagctacaacaagattattacatttaagc |
38038383 |
T |
|
| Q |
81 |
agcgttctaaatgcgagtgtcccaaagtgattcttgctgaactttaccactcttcaagagttccgcgatttcctctggagggttcaaaccaagcttcaca |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38038382 |
agcgttctaaatgcgagtgtcccaaagtgattcttgctgaactttaccactcttcaagagttccgcgatttcctccggagggttcaaaccaagcttcaca |
38038283 |
T |
|
| Q |
181 |
gcacgctccaagcgtgccagcctcgtcatccccatacaaggcccatacttcatgttcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38038282 |
gcacgctccaagcgtgccagcctcgtcatccccatacaaggcccatacttcatgttcat |
38038224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University