View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18776_high_8 (Length: 505)
Name: NF18776_high_8
Description: NF18776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18776_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 44858897 - 44858684
Alignment:
| Q |
1 |
atttcaacaacaaaaataaaactcaacaccaactaatccaatgaatcaaatctcaaacagaaaatttactcaatttttataaacttaaacctgcattgag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44858897 |
atttcaacaacaaaaataaaactcaacaccaaccaatccaatgaatcaaatctcaaacagaaaatttactcaatttttataaacttaaacctgcattgag |
44858798 |
T |
 |
| Q |
101 |
aagcatgctacgatcttggtggtaatgctctataatcggtaccaaatcctttgaaacgatgttccatttacacacttgcttgaacacatcgcgggattgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44858797 |
aagcatgctacgatcttggtggtaatgctctataatcggtaccaaatcctttgaaacgatgttccatttacacactagcttgaacacatcgcgggattgc |
44858698 |
T |
 |
| Q |
201 |
ggatcatcacgtct |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
44858697 |
ggatcatcacgtct |
44858684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 156; E-Value: 1e-82
Query Start/End: Original strand, 336 - 491
Target Start/End: Complemental strand, 44858562 - 44858407
Alignment:
| Q |
336 |
caaattcattcataccgagacagtattcacccttggaataaccgattcgtttgccttcatcatcttcttcaatggcgccgagaccgctgcagattaggga |
435 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44858562 |
caaattcattcataccgagacagtattcacccttggaataaccgattcgtttgccttcatcatcttcttcaatggcgccgagaccgctgcagattaggga |
44858463 |
T |
 |
| Q |
436 |
taatccatcggtgtccatggtgtttgggttttgagagaacgaagagatttggggat |
491 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44858462 |
taatccatcggtgtccatggtgtttgggttttgagagaacgaagagatttggggat |
44858407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University