View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18776_low_12 (Length: 453)
Name: NF18776_low_12
Description: NF18776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18776_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 11749468 - 11749733
Alignment:
| Q |
1 |
atttgttgaatgtgaatgaatgatgcatatctctttgcaacgccattgtaaaactgtctgttcctatca---------tcatcatcatcactttcagttc |
91 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
11749468 |
atttgttgaatgggaatgaatgatgcatatctctttgcaacgccatcgtaaaactgtttgttcctatcatcatcatcatcatcatcatcactttcagttc |
11749567 |
T |
 |
| Q |
92 |
cactttcattgctaacgatataatcaggcaatggattttgattctctatcatttctttcctctaatcatcgtcatcagtgacgtcactgataacgatgat |
191 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11749568 |
cactttcattgctaacgatataaccaagcaatggattttgattctctatcatttctttcctctgatcatcgtcatcagtgacgtcactgataacgatgat |
11749667 |
T |
 |
| Q |
192 |
gttgttatattcgaaaccgtgaccatgttgttgttgggttatagaagctacattgctgagtggagg |
257 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11749668 |
gttgttatattcgaaaccgtggccatgttgttgttgggttatagaagctacattgctgagtggagg |
11749733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 303 - 373
Target Start/End: Original strand, 11749767 - 11749837
Alignment:
| Q |
303 |
ttgtttttggttggtattggaattttcagttcttgggtccattttcttctgttcttgctttcccgcgtgaa |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11749767 |
ttgtttttggttggtattggaattttcagttcttgggtccattttcttctgttcttgctttcccgcgtgaa |
11749837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University