View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18776_low_44 (Length: 249)
Name: NF18776_low_44
Description: NF18776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18776_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 164
Target Start/End: Complemental strand, 6705440 - 6705277
Alignment:
| Q |
1 |
tataacatttatttatatatgattcatgtcaactattttaagctagtgcaatttaattagtttttgtgatgaatattcacttggattttcaaaaatataa |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6705440 |
tataacatatatttatatatgattcatgtcaactattttaagctagtgcaatttaattagtttttgtgatgaatattcacttggattttcaataatataa |
6705341 |
T |
 |
| Q |
101 |
tgcagattgaaagaaccattcttgccacaaatacctaagaactatcttagaatcaagtaagtga |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6705340 |
tgcagattgaaagaaccattcttgccacaaatacctaagaactatcttagaattaagtaagtga |
6705277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University