View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18776_low_47 (Length: 236)
Name: NF18776_low_47
Description: NF18776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18776_low_47 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 103 - 236
Target Start/End: Original strand, 9020205 - 9020339
Alignment:
| Q |
103 |
acaagtaaattttatagttatgattaattacgaaagaatttggtt-acgtctaaaacttttttatcatcgccaaatagacgatttaaggacataccagtc |
201 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9020205 |
acaagtaaattttacagttatgattaactacgaaagaatttggtttacgtctaaaacttttttatcatcgccaaatagacgatttaaggacataccagtc |
9020304 |
T |
|
| Q |
202 |
cttccgttgagaaaatatttagtgaacgctactac |
236 |
Q |
| |
|
|||| | ||||||||||||||| |||||||||||| |
|
|
| T |
9020305 |
cttcagctgagaaaatatttagcgaacgctactac |
9020339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 23 - 108
Target Start/End: Original strand, 9020091 - 9020176
Alignment:
| Q |
23 |
ccattaatcagatcttttccaatgctattatgaatcacaaaaatgtgtttcctttattgtttggaaagagacggccagtgacaagt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9020091 |
ccattaatcagatcttttccaatgctattatgaatcacaaaaatgtgtttcctttattgtttggaaagagacggccggtgacaagt |
9020176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University