View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18778_low_11 (Length: 239)
Name: NF18778_low_11
Description: NF18778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18778_low_11 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 16192980 - 16193200
Alignment:
| Q |
19 |
atcttccatttcaacacaaaaatgtcagaaacagtgatatcttaactatcacaaacaattaatacggagaaaaactgaacaagaatcatgtttcttttag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| ||||||||||||| |
|
|
| T |
16192980 |
atcttccatttcaacacaaaaatgtcagaaacagtgatatcttaactatcacaaacaattaataaggagaaaaactgaaaaagaatgatgtttcttttag |
16193079 |
T |
 |
| Q |
119 |
tactcataagccttacaaaatggttttggtaccaagtgattgtcaaaacttgttatcaaactgcaagcatattgatatataattgctttaattttgttga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| ||||||||| ||||| |||||||||||||||| |
|
|
| T |
16193080 |
tactcataagccttacaaaatggttttggtaccatatgattatcaaaacttgttatcaaactgcaaggatattgatacataatggctttaattttgttga |
16193179 |
T |
 |
| Q |
219 |
tctttcatctaagccacttca |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
16193180 |
tctttcatctaagccacttca |
16193200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University