View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1877_high_12 (Length: 250)

Name: NF1877_high_12
Description: NF1877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1877_high_12
NF1877_high_12
[»] chr4 (1 HSPs)
chr4 (155-250)||(53998840-53998935)


Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 155 - 250
Target Start/End: Original strand, 53998840 - 53998935
Alignment:
155 gtatttgtgttcttagtaaatgcatcaaaacttgacagaattcttagatgttgtgtgacgaaaaattgcaattgatcacaaccaaccaaaacttga 250  Q
    |||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53998840 gtatttgtgttcttagtaaatgcatcaatacttgacacaattcttagatgttgtgtgacgaaaaattgcaattgatcacaaccaaccaaaacttga 53998935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University