View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1877_high_14 (Length: 239)
Name: NF1877_high_14
Description: NF1877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1877_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 14346415 - 14346635
Alignment:
| Q |
1 |
cttcttacctattatggtttggaagtgtctgctgctttgtttttctgnnnnnnncaggttaagattggaaaacaagtgggttgggtttcgattaatggta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14346415 |
cttcttacctattatggtttggaagtgtctgctgctttgtttttctgtttttttcaggttaagattggaaaacaagtgggttgggtttcgattaatggta |
14346514 |
T |
 |
| Q |
101 |
ttccgggtcgaaaattgttggagagctttgatcaatcttataaaaactttaaagctaggttttttaaaatttgggctgttccaggtgaaccttattttct |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14346515 |
ttccgggtcgaaaattgtttgagagctttgatcaatcttataaaaactttaaagctaggttttttaaaatttgggctgttccaggtgaaccttattttct |
14346614 |
T |
 |
| Q |
201 |
tttgaatagggatgatggtaa |
221 |
Q |
| |
|
|||||||| |||||||||||| |
|
|
| T |
14346615 |
tttgaataaggatgatggtaa |
14346635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University