View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1877_high_7 (Length: 349)
Name: NF1877_high_7
Description: NF1877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1877_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 195 - 326
Target Start/End: Complemental strand, 16470518 - 16470387
Alignment:
| Q |
195 |
caaactactcggggatctgtcttctatttccaatttgttttcttctttttatcattaattaagatttacaacaatggtatttagacacgtcatattcttt |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16470518 |
caaactactcggggatctgtcttctatttccaatttgttttcttctttttatcattaattaagatttacaacaatggtatttagacacatcatattcttt |
16470419 |
T |
|
| Q |
295 |
aatgcatcatttatctccatctatctcttcct |
326 |
Q |
| |
|
||| |||||||||||||||||||||||||||| |
|
|
| T |
16470418 |
aatacatcatttatctccatctatctcttcct |
16470387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 17 - 123
Target Start/End: Complemental strand, 16470696 - 16470590
Alignment:
| Q |
17 |
tatctatgatgttttatattcttttgtatttcttgatgcattttatggtgtagtagagatatatactctgaatatcatgccagatccatcttctcttaat |
116 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16470696 |
tatctatgatgttttatgtttttttgtatttcttgatgcattttatggtgtagtagagatatatactctgaatatcatgccagacccatcttctcttaat |
16470597 |
T |
|
| Q |
117 |
gcaattt |
123 |
Q |
| |
|
||||||| |
|
|
| T |
16470596 |
gcaattt |
16470590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University