View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1877_low_12 (Length: 300)
Name: NF1877_low_12
Description: NF1877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1877_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 1 - 164
Target Start/End: Complemental strand, 38186982 - 38186819
Alignment:
| Q |
1 |
aattcattttgagccctaatcattgaattggtgtttgaatttcaaccttcatggccttgattctcataatcgcttctttcattttcctttggattatttc |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38186982 |
aattcattttgagcactaatcattgaattggtgtttcaatttcaaccttcatggccttgattctcataatcgcttctttcattttcctttggattatttc |
38186883 |
T |
|
| Q |
101 |
tctatgcaaaattttccttctcccccgtacccctttcaccaaacattttaccctcgatggtaag |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38186882 |
tctatgcaaaattttccttctcccccgtacccctttcaccaaacattttaccctcgatggtaag |
38186819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 249 - 290
Target Start/End: Complemental strand, 38186733 - 38186692
Alignment:
| Q |
249 |
ggaagagaaatgtcttgctggttattgctcaccctgatgatg |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38186733 |
ggaagagaaatgtcttgctggttattgctcaccctgacgatg |
38186692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University