View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1877_low_13 (Length: 279)
Name: NF1877_low_13
Description: NF1877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1877_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 113 - 260
Target Start/End: Original strand, 16857606 - 16857753
Alignment:
| Q |
113 |
aaatatcagtcaaaatataacttaaagatggcaataactttgaaaatcttcttaaatatgactattttgatttgaaatttcattgaccaattaagatttt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
16857606 |
aaatatcagtcaaaatataacttaaagatggcaataactttgaaaatcttcttaaatatgactattttgatttaaaatttaattgaccaattaagatttt |
16857705 |
T |
 |
| Q |
213 |
tagtctaatattatgaataggaaaattaataaatatacctgaaaattc |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16857706 |
tagtctaatattatgaataggaaaattaataaatatacctgaaaattc |
16857753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University