View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1877_low_15 (Length: 250)
Name: NF1877_low_15
Description: NF1877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1877_low_15 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 155 - 250
Target Start/End: Original strand, 53998840 - 53998935
Alignment:
| Q |
155 |
gtatttgtgttcttagtaaatgcatcaaaacttgacagaattcttagatgttgtgtgacgaaaaattgcaattgatcacaaccaaccaaaacttga |
250 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53998840 |
gtatttgtgttcttagtaaatgcatcaatacttgacacaattcttagatgttgtgtgacgaaaaattgcaattgatcacaaccaaccaaaacttga |
53998935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University