View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1877_low_16 (Length: 248)
Name: NF1877_low_16
Description: NF1877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1877_low_16 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 8 - 248
Target Start/End: Complemental strand, 9084883 - 9084643
Alignment:
| Q |
8 |
tgagatgaaactatgattagtggtgtttgaaggctcacaaaaaccctagcccttatcaaaattgtggttgccaaagagagatcaagaagtccttgatttt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9084883 |
tgagatgaaactatgattagtggtgtttgaaggctcacaagaaccctagcccttatcaaaattgtggttgccaaagagagatcaagaagtccttgatttt |
9084784 |
T |
 |
| Q |
108 |
tgtgagatgttcctttaaattatgaaatcagcgaattttatattcgtaactcgtagctttgtgtatgcaagattcccttttccaatagttacattcaaac |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9084783 |
tgtgagatgttcctttaaattatgaaatcagcgaattttatattcataactcgtagctttgtgtatgcaagattcccttttccaatagttacattcaaac |
9084684 |
T |
 |
| Q |
208 |
atcgtgggatgctgggatatttacttaaacccttgcattct |
248 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
9084683 |
atcgtgggatgctggtatatttccttaaacccttgcattct |
9084643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University