View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1877_low_23 (Length: 215)
Name: NF1877_low_23
Description: NF1877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1877_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 138 - 186
Target Start/End: Original strand, 35159575 - 35159623
Alignment:
| Q |
138 |
agaaaatattttctacacttatccttatctttatttattaattttgtta |
186 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35159575 |
agaaaatattttctacacttatccttatccttatttattaattttgtta |
35159623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 138 - 186
Target Start/End: Complemental strand, 37198250 - 37198202
Alignment:
| Q |
138 |
agaaaatattttctacacttatccttatctttatttattaattttgtta |
186 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
37198250 |
agaaaatattttctacacttatccttatcgttattttttaattttgtta |
37198202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 138 - 186
Target Start/End: Complemental strand, 37198434 - 37198386
Alignment:
| Q |
138 |
agaaaatattttctacacttatccttatctttatttattaattttgtta |
186 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
37198434 |
agaaaatattttctacacttatctttatccttatttattaattttgtta |
37198386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000007; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 138 - 186
Target Start/End: Complemental strand, 23952733 - 23952688
Alignment:
| Q |
138 |
agaaaatattttctacacttatccttatctttatttattaattttgtta |
186 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23952733 |
agaaaatattttctacacttatcctta---ttatttattaattttgtta |
23952688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 186
Target Start/End: Original strand, 24046051 - 24046083
Alignment:
| Q |
154 |
acttatccttatctttatttattaattttgtta |
186 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
24046051 |
acttatccttatccttatttattaattttgtta |
24046083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University