View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1877_low_9 (Length: 336)
Name: NF1877_low_9
Description: NF1877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1877_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 12 - 319
Target Start/End: Original strand, 27422399 - 27422704
Alignment:
| Q |
12 |
tatactattggcttgattataaaaaagaactattatttagcatgaagtttgcgattttgatatgcattttatggtttctgtgagtcttaaattggatcta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| |||||||| || |
|
|
| T |
27422399 |
tatactattggcttgattataaaaaagaactattatttagcatgaagtttgcgattttgatatgtattttatggtttttgtgagtcttgaattggatata |
27422498 |
T |
|
| Q |
112 |
atggttgtctcctaccattcatgctaaatattttgcttgaggaaattttaagttcttaagcaaagaacgtattgaatttcattcttccnnnnnnncttta |
211 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27422499 |
ttggttgtctcctaccattcaggctaaatattttgcttgaggaaattttaagttcttaagcaaagaacgtattgaatttcattcttcctttttttcttta |
27422598 |
T |
|
| Q |
212 |
tcaaaatacaacattgtgttatgttatgcaataaaactagatgagtatatcgagtctttaaaataaagagcatattgaattcttttgctggtgtgttggt |
311 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27422599 |
tcaaaatataacattgtgttgtgttatgcaataaaactagatgagtatatcgagtctttaaaataaagagcatattgaattc--ttgctggtgtgttggt |
27422696 |
T |
|
| Q |
312 |
tatgctga |
319 |
Q |
| |
|
|||||||| |
|
|
| T |
27422697 |
tatgctga |
27422704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University