View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18780_high_11 (Length: 296)
Name: NF18780_high_11
Description: NF18780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18780_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 38130606 - 38130303
Alignment:
| Q |
1 |
catccgtatgatctgtttgtacaatgttcatgcgtatgatcttttttcaatcacgtttctttaatatcattaggtatctcctctgattcttctctctttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| || |
|
|
| T |
38130606 |
catccgtatgatctgtttgtacaatgttcatgtgtatgatcttttttcaatcacgtttctttaatatcattagatatctcctctgattcttttctctatt |
38130507 |
T |
 |
| Q |
101 |
aactgagtattctttttcgttactagttgctgttatttgcaaggatgatgaacaacaa------aggtagagggct------------------gaactt |
176 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
38130506 |
aactgagcattcttttttgttactagttgctgttatttgcaaggatgatgaacaacaatggtagaggtagagggctttcaacctgtggagggatgaactt |
38130407 |
T |
 |
| Q |
177 |
tgaccatcttctccgaatgcatttgtaagttctttaacaattcctcctaaattttaaaagtttttgcaataatgttttcatatcttctttcagaatttct |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38130406 |
tgaccatcttctccgaatgcatttgtaagttctttaacaactcctcctaaattttaaaagtttttgcaataatgttttcatatcttctttgagaatttct |
38130307 |
T |
 |
| Q |
277 |
tgga |
280 |
Q |
| |
|
|||| |
|
|
| T |
38130306 |
tgga |
38130303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 236 - 287
Target Start/End: Complemental strand, 38130295 - 38130244
Alignment:
| Q |
236 |
gtttttgcaataatgttttcatatcttctttcagaatttcttggatattctt |
287 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38130295 |
gtttttacaataatgttttcatatcttctttcagaatttcttggacattctt |
38130244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University