View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18780_high_16 (Length: 239)
Name: NF18780_high_16
Description: NF18780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18780_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 25026114 - 25025895
Alignment:
| Q |
1 |
ttttataattaaacaaactagctaattcacttgcctcttgtgaactctctggaatcgaatttcccttaatatcatactttataaaaatatgaattagtca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25026114 |
ttttataattaaacaaactagctaattcacttgcctcttgtgaactctctggaatcgaatttcccttaatatcatactttataaaa-tatgaattagtca |
25026016 |
T |
 |
| Q |
101 |
aattcgatttaattaatgtatgctttatattttctatttaattattcggacagcagttgccttaaccaactttgcctcctatctatgatgcatgtcatac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25026015 |
aattcgatttaattaatgtatgctttatattttctttttaattattcggacagcacttgccttaaccaactttgcctcctatctatgatgcatgtcatac |
25025916 |
T |
 |
| Q |
201 |
gtatttattcgttgtgtccat |
221 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
25025915 |
gtatttgttcgttgtgtccat |
25025895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University