View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18780_low_13 (Length: 307)
Name: NF18780_low_13
Description: NF18780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18780_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 6e-77; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 10843200 - 10843388
Alignment:
| Q |
1 |
tgagtacataaatggacttatttatagacctcaattacactaaccagctctctgaaccaacttataagttataaccatacccaactaacctaccaattct |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10843200 |
tgagtacatgaatggacttatttatagacctcaattacaccaaccagctctctcaaccaacttat-------aaccatacccaactaacctaccaattct |
10843292 |
T |
 |
| Q |
101 |
aactatctctagttgaataagtatgctgtaatagtttgtaagggtttaacaaatgcatatttcattaatgggggtttctaacatggtagaaagtaa |
196 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10843293 |
aactaactctagttgaatatgtatgctgtaatagtttgtaagggtttaacaaatgcatatttcatgaatgggggtttctaacatggtagaaagtaa |
10843388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 192 - 292
Target Start/End: Original strand, 10843460 - 10843561
Alignment:
| Q |
192 |
agtaattattatactcagtgctcagcagttagttatgct-ccagcttatcagttggttacagttgtctctttttgttcaagacagttgcaacttacaaac |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10843460 |
agtaattattatactcagtgctcagcagttagttatgctgccagcttatcagttggttacaattgtctctttttgttcaagacagttgcaacttacaaac |
10843559 |
T |
 |
| Q |
291 |
tg |
292 |
Q |
| |
|
|| |
|
|
| T |
10843560 |
tg |
10843561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 3961222 - 3961265
Alignment:
| Q |
1 |
tgagtacataaatggacttatttatagacctcaattacactaac |
44 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||| |||||| |
|
|
| T |
3961222 |
tgagtacatatatggtcttatttatagacctcaattatactaac |
3961265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University