View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18780_low_23 (Length: 226)

Name: NF18780_low_23
Description: NF18780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18780_low_23
NF18780_low_23
[»] chr7 (1 HSPs)
chr7 (1-50)||(25503805-25503854)


Alignment Details
Target: chr7 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 25503854 - 25503805
Alignment:
1 tctttctaggatacaattaggcatatctatttgattgttgttaatgtttg 50  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
25503854 tctttctaggatacaattaggcatatctatttgattgttgttaatgtttg 25503805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University