View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18781_low_5 (Length: 336)
Name: NF18781_low_5
Description: NF18781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18781_low_5 |
 |  |
|
| [»] scaffold0161 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 244
Target Start/End: Original strand, 32456794 - 32457020
Alignment:
| Q |
18 |
actacacctttcggagacgaagtcgttccggaggtgtagtttaacgtaattggatcccactctgagtcaggtcgaatccatttgaaatatggatcaccct |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32456794 |
actacacctttcggagacgacgtcgttccggaggtgtagtttaacgtaattggatcccactctgagtcaggtcggatccatttgaaatatggatcaccct |
32456893 |
T |
 |
| Q |
118 |
ttgctgcaagaccctcataggtgttgataatgtttacgttttttggaagtggaggaatctggtgcggtgctagggtttcatccattatgaggacgagctt |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32456894 |
ttgctacaagaccctcataggtgttgataatgtttacgttttttggaagtggaggaatctggtgcggtgctagggtttcatccattatgaggacgagctt |
32456993 |
T |
 |
| Q |
218 |
aggttgttggatgtttgttgggaataa |
244 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
32456994 |
aggttgttggatgtttgttgggaataa |
32457020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 18 - 244
Target Start/End: Complemental strand, 32464341 - 32464115
Alignment:
| Q |
18 |
actacacctttcggagacgaagtcgttccggaggtgtagtttaacgtaattggatcccactctgagtcaggtcgaatccatttgaaatatggatcaccct |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |||| ||||||||||||||| ||||||||| | |
|
|
| T |
32464341 |
actacacctttcggagatgaagtcgttccggaggtgtagtttaacgtaataggatcccactctgagttaggttgaatccatttgaaatttggatcacctt |
32464242 |
T |
 |
| Q |
118 |
ttgctgcaagaccctcataggtgttgataatgtttacgttttttggaagtggaggaatctggtgcggtgctagggtttcatccattatgaggacgagctt |
217 |
Q |
| |
|
||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
32464241 |
ttgttacaagaccctcataggtgttgataatgtttacgttttttggaagtggaggaatctggtttggtgctagggtttcatccatgatgaggacgagctt |
32464142 |
T |
 |
| Q |
218 |
aggttgttggatgtttgttgggaataa |
244 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
32464141 |
aggttgttggatgtttgttgggaataa |
32464115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 279 - 336
Target Start/End: Original strand, 32457055 - 32457112
Alignment:
| Q |
279 |
atgtcaacaaaaatgagttttgattcactgtggatgagaagaacggagagggttttgt |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32457055 |
atgtcaacaaaaatgagttttgattcactgtggatgagaagaacggagagggttttgt |
32457112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 279 - 336
Target Start/End: Complemental strand, 32464080 - 32464023
Alignment:
| Q |
279 |
atgtcaacaaaaatgagttttgattcactgtggatgagaagaacggagagggttttgt |
336 |
Q |
| |
|
||||||||||| |||||||| |||||||| |||||||| ||||| |||||| |||||| |
|
|
| T |
32464080 |
atgtcaacaaagatgagtttcgattcactatggatgaggagaacagagaggcttttgt |
32464023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0161 (Bit Score: 83; Significance: 3e-39; HSPs: 2)
Name: scaffold0161
Description:
Target: scaffold0161; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 21 - 220
Target Start/End: Complemental strand, 23768 - 23563
Alignment:
| Q |
21 |
acacctttcggagacgaagtcgttccggaggtgtagtttaacgtaattggatcccactctgagtcaggtcgaatccatttgaaatatggatcaccctttg |
120 |
Q |
| |
|
|||||||| |||||||| || ||||||||||||||||| | |||||||||||||||||| | ||| || || ||||||||||||| |||||||||||||| |
|
|
| T |
23768 |
acaccttttggagacgacgttgttccggaggtgtagttcagcgtaattggatcccactcggtgtcgggacggatccatttgaaatttggatcaccctttg |
23669 |
T |
 |
| Q |
121 |
ctgcaagaccc------tcataggtgttgataatgtttacgttttttggaagtggaggaatctggtgcggtgctagggtttcatccattatgaggacgag |
214 |
Q |
| |
|
|| |||||| | || |||||||| |||||||||| |||||||||||||| |||||||||| ||| || ||||||||||| ||||||||||| |
|
|
| T |
23668 |
ctacaagactctcgtagtcgtaggtgttcataatgtttatgttttttggaagtgatggaatctggtccggcaataacgtttcatccatgatgaggacgag |
23569 |
T |
 |
| Q |
215 |
cttagg |
220 |
Q |
| |
|
|||||| |
|
|
| T |
23568 |
cttagg |
23563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0161; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 279 - 336
Target Start/End: Complemental strand, 23504 - 23447
Alignment:
| Q |
279 |
atgtcaacaaaaatgagttttgattcactgtggatgagaagaacggagagggttttgt |
336 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| || ||||||||||||||| |
|
|
| T |
23504 |
atgtcaacaaagatgagtttcgattcactgtggatgagcagcgcggagagggttttgt |
23447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University