View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18782_low_1 (Length: 222)
Name: NF18782_low_1
Description: NF18782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18782_low_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 53 - 159
Target Start/End: Original strand, 3038099 - 3038205
Alignment:
| Q |
53 |
cattttacactttattcagtttagaggagccatatttcaatattatcattatgtttcgttccatttactttaggatattcaaagtatctcatgagatgat |
152 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3038099 |
cattttacactttattcactttagaggatccatatttcaacattatcattatgtttcgttccatttactttaggatattcaaagtatctcatgagatgat |
3038198 |
T |
 |
| Q |
153 |
aatctag |
159 |
Q |
| |
|
||||||| |
|
|
| T |
3038199 |
aatctag |
3038205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 3038042 - 3038081
Alignment:
| Q |
1 |
ttaagaaaaatcatgagtttatttaaataacaacccttaa |
40 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
3038042 |
ttaaggaaaatcatgagtttatttaaatagcaacccttaa |
3038081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 38
Target Start/End: Complemental strand, 31389175 - 31389145
Alignment:
| Q |
8 |
aaatcatgagtttatttaaataacaaccctt |
38 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31389175 |
aaatcatgagtttatttaaataacaaccctt |
31389145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University