View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18783_low_13 (Length: 315)
Name: NF18783_low_13
Description: NF18783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18783_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 19 - 301
Target Start/End: Original strand, 46872867 - 46873149
Alignment:
| Q |
19 |
ctcatacccaatagttctttaaccaaattctcatcttcaaaacccaacaatgttatcaataacatcactccaatttccattgattcttccattttctcca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46872867 |
ctcatacccaatagttctttaaccaaattctcatcttcaaaacccaacaatgttaacaataacatcactccaatttccattgattcttccattttctcca |
46872966 |
T |
|
| Q |
119 |
cacccgaaaacagttctgacggtgtaatagcgccgtctactcctgttatcaagtcaagtgctaaatcaaatcatgttgttcagagaattgaaagaaagaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46872967 |
cacccgaaaacagttctgacggtgtaatagcgccgtctactcctgttatcaagtcaagtgctaaatcaaatcatgttgttcagagaattgaaagaaagaa |
46873066 |
T |
|
| Q |
219 |
aaagggtgaaaagaggtgtttttactctggtttaggtttattgaagatgatgatggttttgggggttcttttgtttgctgatg |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46873067 |
aaagggtgaaaagaggtgtttttactctggtttaggtttattgaagatgatgatggttttgggggttcttttgtttgctgatg |
46873149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University