View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18783_low_21 (Length: 201)
Name: NF18783_low_21
Description: NF18783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18783_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 6e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 23 - 185
Target Start/End: Complemental strand, 45745217 - 45745055
Alignment:
| Q |
23 |
atgtactttagatgtgacgttgattaactaaatagtaatcaagaaagnnnnnnngacaaaacatatatacttgaaggaagcttgcatggcaagaaacatg |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45745217 |
atgtactttagatgtgacgttgattaactaaatagtaatcaagaaagaaaaaaagacaaaacatatatacttgaaggaagcctgcatggcaagaaacatg |
45745118 |
T |
 |
| Q |
123 |
atgtgatccatctagcaagccaagccattgtggttatttttgtgtgtgatttgtttagatctt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45745117 |
atgtgatccatctagcaagccaagccattgtggttatttttgtgtgtgttttgtttagatctt |
45745055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 89 - 185
Target Start/End: Complemental strand, 45734264 - 45734168
Alignment:
| Q |
89 |
atacttgaaggaagcttgcatggcaagaaacatgatgtgatccatctagcaagccaagccattgtggttatttttgtgtgtgatttgtttagatctt |
185 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
45734264 |
atacttgaaggaagcctgcatagcaagaaacatgatgtgatccatctagcaagccaagccattgtgcttatttttatgtgtgatttgtttagctctt |
45734168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University