View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18784_low_17 (Length: 217)
Name: NF18784_low_17
Description: NF18784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18784_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 12 - 201
Target Start/End: Complemental strand, 36845630 - 36845441
Alignment:
| Q |
12 |
gaagaatatagtatataattagcgttagtggcaagtttcatttgataagatgatagcaagcaacaaagaagaattgataatgagaaagaaacaaacctgt |
111 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36845630 |
gaagaatgtagtatataattagcgttcgtggcaagtttcatttgataagatgatagcaagcaacaaagaagaattgataatgagaaagaaacaaacctgt |
36845531 |
T |
 |
| Q |
112 |
tgtcgtgagcagatgagcgtgacgcggcgcgggactggcccatttctcagtagcaagcagcagctcagcgttagttttgtggggtatttg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36845530 |
tgtcgtgagcagatgagcgtgacgcggcgcgggactggcccatttctcagtagcaagcagcagctcagcgttagttttgtggggtatttg |
36845441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University