View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18786_high_29 (Length: 269)
Name: NF18786_high_29
Description: NF18786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18786_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 14 - 212
Target Start/End: Original strand, 47520104 - 47520312
Alignment:
| Q |
14 |
ttctaactaactgaattaaaaagatctaattggcgggaagaggaaaatagaatgaaacttgtgttagaagatatggcatgattg--------gcatcaat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
47520104 |
ttctaactaactgaattaaaaagatctaattggcgggaagaggaaaatagaatgaaacttgtgttacaagatatggcatgattgccagcatggcatcaat |
47520203 |
T |
 |
| Q |
106 |
gtgtaactgccaagacaactcagcaaaaacagaaaactgaaccgtgtcaacaaaaagctaactgaat--atgggagtttgtaagagaaaattgtaacata |
203 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| || |||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
47520204 |
gtgtaactgccaagacaactcagcaaaaatagaaaactgaaccgtctcgacaaaaagctaactgaattaactggagtttgtaagagaaaattgtaacata |
47520303 |
T |
 |
| Q |
204 |
ataatctca |
212 |
Q |
| |
|
||||||||| |
|
|
| T |
47520304 |
ataatctca |
47520312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University