View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18786_high_36 (Length: 250)
Name: NF18786_high_36
Description: NF18786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18786_high_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 6 - 160
Target Start/End: Complemental strand, 46723726 - 46723572
Alignment:
| Q |
6 |
gtagattattcttcctgtgaaatataacttgctttgctttgatctgtctattcttcacatcaaccttgtttccacacaggacaatgggtatattctcaca |
105 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46723726 |
gtagattcttcttcctgtgaaatataacttgctttgctttgatctgtctattcttcacatcaaccttgtttccacacaggacaatgggtatattctcaca |
46723627 |
T |
 |
| Q |
106 |
cacactgattattaacaagaatttaagagtcccaaattagtaagctgaaaaattg |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46723626 |
cacactgattattaacaagaatttaagagtcccaaattagtaagctgaaaaattg |
46723572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 198 - 235
Target Start/End: Complemental strand, 46723578 - 46723541
Alignment:
| Q |
198 |
aaaattgatgaaatcagtgaactgaccgagtgatatct |
235 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46723578 |
aaaattgatgaaattagtgaactgaccgagtgatatct |
46723541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University