View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18786_high_38 (Length: 248)
Name: NF18786_high_38
Description: NF18786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18786_high_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 2891645 - 2891883
Alignment:
| Q |
1 |
tctctcatcttctgtgttgctcccaatgatacacgtggagtttgaattcaaaggtgtgggactagaagatgatggtgttgatagaagttgatttgaagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2891645 |
tctctcatcttctgtgttgctcccaatgatacacgtggagtttgaattcaaaggtgtgggactagaagatgacggtgttgatagaagttgatttgaagtt |
2891744 |
T |
 |
| Q |
101 |
tgatagtaaataagattttgattatcagaaccataataattattatagtttgataattgagggatataatcctcctcttttaaggtacttagaccaaacc |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2891745 |
tgatagtacataagattttgattatcagaaccataataattattatagtttgataattgagggatataatcctcctcttttaagttacttagaccaaacc |
2891844 |
T |
 |
| Q |
201 |
cattattttggtggcaatcaatatcatgaacagaatatt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2891845 |
cattattttggtggcaatcaatatcatgaacagaatatt |
2891883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University