View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18786_high_39 (Length: 242)
Name: NF18786_high_39
Description: NF18786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18786_high_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 20 - 229
Target Start/End: Original strand, 45738809 - 45739019
Alignment:
| Q |
20 |
gtctagaggtgccatgttggatttgagagctttgacaccgatttggaggcagtgacggagagcttcttcgcgtggttgacggcgttccagtggaagtgaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45738809 |
gtctagaggtgccatgttggatttgagagctttgacaccgatttggaggcagtgacggagagcttcttcgcgtggttgacggcgttccagtggaagtgaa |
45738908 |
T |
|
| Q |
120 |
tatggtatgtcgccggcgccgccgtgtaaagctattgcccaacccatgagttgc-nnnnnnnctgatttctgattcacgcaactctctcactcaattttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45738909 |
tatggtatgtcgccggcgccgccgtgtaaagctattgcccaacccatgagttgcttttttttctgatttctgattcacgcaactctctcactcaattttc |
45739008 |
T |
|
| Q |
219 |
gatgatgatgt |
229 |
Q |
| |
|
||||||||||| |
|
|
| T |
45739009 |
gatgatgatgt |
45739019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 20 - 124
Target Start/End: Original strand, 45733384 - 45733488
Alignment:
| Q |
20 |
gtctagaggtgccatgttggatttgagagctttgacaccgatttggaggcagtgacggagagcttcttcgcgtggttgacggcgttccagtggaagtgaa |
119 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |||| ||||||||||| |
|
|
| T |
45733384 |
gtctagaggggacatgttggatttgagagctttgacaccaatttggaggcagtgacggagagcttcttcgcgtggctgacgggcttccggtggaagtgaa |
45733483 |
T |
|
| Q |
120 |
tatgg |
124 |
Q |
| |
|
|||| |
|
|
| T |
45733484 |
aatgg |
45733488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University