View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18786_low_36 (Length: 292)
Name: NF18786_low_36
Description: NF18786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18786_low_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 33262297 - 33262054
Alignment:
| Q |
1 |
tctcattctcagtggcgccagggggtcttgaactagctccatcaatgggtccattgactgaatgacccaaaatcattgagctcagctcttctgaagttgg |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33262297 |
tctcattctcagtggcgctagggggtcttgaactagctccatcaatgggtccatttactgaatgacccaaaatcattgagctcagctcttctgaaattgg |
33262198 |
T |
|
| Q |
101 |
gatgttgaaaggcagacttgctggcccttgcaatgtggcattctgcggttgcaaactagtcattgttgacccctccaatatggcagtttgtggttgcaga |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33262197 |
gatgttgaaaggcagacttgttggcccttgcagtgtggcattctgcggttgcaaactagtcattgttgacccctccaatatggcagttcgtggttgcaga |
33262098 |
T |
|
| Q |
201 |
tgactaattgctggcccttccaacatggcactctgtggttgcaa |
244 |
Q |
| |
|
| |||||||| ||||||||||||||||||| |||||||| |||| |
|
|
| T |
33262097 |
ttactaattgatggcccttccaacatggcagtctgtggtagcaa |
33262054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 228 - 282
Target Start/End: Complemental strand, 33262025 - 33261971
Alignment:
| Q |
228 |
gcactctgtggttgcaactcagtcatcgctggcccttgcaatatcgctctctgtg |
282 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33262025 |
gcactctgtggttccaactcagtcatcgctggcccttgcaatatcgctctctgtg |
33261971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University