View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18786_low_43 (Length: 256)
Name: NF18786_low_43
Description: NF18786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18786_low_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 11 - 238
Target Start/End: Complemental strand, 35276564 - 35276337
Alignment:
| Q |
11 |
cacagaaactaaatctctaggcatgttatccatgtgggtggggggaagaaagctatcttgctatttacaataatttgttttgggtgggcttatgaagtga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
35276564 |
cacagaaactaaatctctaggcatgttatccatgtgggtggggggaagaaagctatcttgctatttacaataatttgttttgggtgggcttatgaagcga |
35276465 |
T |
|
| Q |
111 |
cgattcgtgtgaatatattgtccaaaggctacatgtatgatctggacttgccagatagattatattgtattctactattctatatcctaacatattgtac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35276464 |
cgattcgtgtgaatatattgtccaaaggctacatgtatgatctggacttgccagatagattatattgtattctactattctatatcctaacatattgtac |
35276365 |
T |
|
| Q |
211 |
caatatgtgccatcaatatagaccatgt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
35276364 |
caatatgtgccatcaatatagaccatgt |
35276337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 184
Target Start/End: Complemental strand, 35243704 - 35243672
Alignment:
| Q |
152 |
ctggacttgccagatagattatattgtattcta |
184 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
35243704 |
ctggacttaccagatagattatattgtattcta |
35243672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University