View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18786_low_48 (Length: 249)
Name: NF18786_low_48
Description: NF18786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18786_low_48 |
 | |
|
| [»] scaffold0041 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 21626514 - 21626754
Alignment:
| Q |
1 |
cttctgaagcactcatcattactatttttgcatccatgcattgttgcacgaatcactcacaaaaaggtgtaataatttggattgttcttttgggtgtgag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21626514 |
cttctgaagcactcatcattactatttttgcatccatgcattgttgcacgaatcactcacaaaaaggagtaataatttggattgttcttttgggtgtgag |
21626613 |
T |
|
| Q |
101 |
tgggtttgtgcagatcactggagagacagtgggagaagtgaaggcagtagcaggcatgcatcaaagaaaagctgagatggctaagcattctgatgctttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21626614 |
tgggtttgtgcagatcactggagagacagtgggagaagtgaaggcagtagcaggcatgcatcaaagaaaagctgagatggctaagcattctgatgctttt |
21626713 |
T |
|
| Q |
201 |
attgccttaccaggttggttcccattccaccaatattcttc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21626714 |
attgccttaccaggttggttcccattccaccaatattcttc |
21626754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 129 - 216
Target Start/End: Complemental strand, 28270807 - 28270720
Alignment:
| Q |
129 |
gtgggagaagtgaaggcagtagcaggcatgcatcaaagaaaagctgagatggctaagcattctgatgcttttattgccttaccaggtt |
216 |
Q |
| |
|
||||||||||| || || ||||||| ||||||||||| || || ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28270807 |
gtgggagaagtaaaagctgtagcagatatgcatcaaaggaaggcagagatggctaagcattcagatgcttttattgccttaccaggtt |
28270720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 117 - 216
Target Start/End: Original strand, 77702 - 77801
Alignment:
| Q |
117 |
actggagagacagtgggagaagtgaaggcagtagcaggcatgcatcaaagaaaagctgagatggctaagcattctgatgcttttattgccttaccaggtt |
216 |
Q |
| |
|
||||| || ||||| |||||||| ||||| || || | ||||||||||| |||||||||||||| || ||||| ||||||||||||||||||||||||| |
|
|
| T |
77702 |
actggtgaaacagtaggagaagttaaggctgttgctgatatgcatcaaaggaaagctgagatggccaaacattcagatgcttttattgccttaccaggtt |
77801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 117 - 216
Target Start/End: Complemental strand, 40888582 - 40888483
Alignment:
| Q |
117 |
actggagagacagtgggagaagtgaaggcagtagcaggcatgcatcaaagaaaagctgagatggctaagcattctgatgcttttattgccttaccaggtt |
216 |
Q |
| |
|
||||| || ||||| |||||||| ||||| || || | ||||||||||| |||||||||||||| || ||||| ||||||||||||||||||||||||| |
|
|
| T |
40888582 |
actggtgaaacagtaggagaagttaaggctgttgctgatatgcatcaaaggaaagctgagatggccaaacattcagatgcttttattgccttaccaggtt |
40888483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 117 - 219
Target Start/End: Complemental strand, 40464674 - 40464572
Alignment:
| Q |
117 |
actggagagacagtgggagaagtgaaggcagtagcaggcatgcatcaaagaaaagctgagatggctaagcattctgatgcttttattgccttaccaggtt |
216 |
Q |
| |
|
||||| || ||||| ||||||||||| |||||||| | |||||||||||| |||||||| ||| ||| |||||||||| ||||| || |||||||||| |
|
|
| T |
40464674 |
actggtgaaacagtaggagaagtgaaagcagtagctgacatgcatcaaaggaaagctgaaatgtctagaaattctgatgcctttatagcattaccaggtt |
40464575 |
T |
|
| Q |
217 |
ggt |
219 |
Q |
| |
|
||| |
|
|
| T |
40464574 |
ggt |
40464572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 156 - 216
Target Start/End: Original strand, 14904728 - 14904788
Alignment:
| Q |
156 |
atgcatcaaagaaaagctgagatggctaagcattctgatgcttttattgccttaccaggtt |
216 |
Q |
| |
|
|||||| |||| || ||||||| ||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
14904728 |
atgcataaaaggaatgctgagacggctaggcattccgatgcttttattgccttaccaggtt |
14904788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University