View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18786_low_50 (Length: 242)

Name: NF18786_low_50
Description: NF18786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18786_low_50
NF18786_low_50
[»] chr4 (2 HSPs)
chr4 (20-229)||(45738809-45739019)
chr4 (20-124)||(45733384-45733488)


Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 20 - 229
Target Start/End: Original strand, 45738809 - 45739019
Alignment:
20 gtctagaggtgccatgttggatttgagagctttgacaccgatttggaggcagtgacggagagcttcttcgcgtggttgacggcgttccagtggaagtgaa 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45738809 gtctagaggtgccatgttggatttgagagctttgacaccgatttggaggcagtgacggagagcttcttcgcgtggttgacggcgttccagtggaagtgaa 45738908  T
120 tatggtatgtcgccggcgccgccgtgtaaagctattgcccaacccatgagttgc-nnnnnnnctgatttctgattcacgcaactctctcactcaattttc 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||    
45738909 tatggtatgtcgccggcgccgccgtgtaaagctattgcccaacccatgagttgcttttttttctgatttctgattcacgcaactctctcactcaattttc 45739008  T
219 gatgatgatgt 229  Q
    |||||||||||    
45739009 gatgatgatgt 45739019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 20 - 124
Target Start/End: Original strand, 45733384 - 45733488
Alignment:
20 gtctagaggtgccatgttggatttgagagctttgacaccgatttggaggcagtgacggagagcttcttcgcgtggttgacggcgttccagtggaagtgaa 119  Q
    ||||||||| | ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||  |||| |||||||||||    
45733384 gtctagaggggacatgttggatttgagagctttgacaccaatttggaggcagtgacggagagcttcttcgcgtggctgacgggcttccggtggaagtgaa 45733483  T
120 tatgg 124  Q
     ||||    
45733484 aatgg 45733488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University