View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18786_low_53 (Length: 239)

Name: NF18786_low_53
Description: NF18786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18786_low_53
NF18786_low_53
[»] chr2 (1 HSPs)
chr2 (16-239)||(33841257-33841480)


Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 16 - 239
Target Start/End: Complemental strand, 33841480 - 33841257
Alignment:
16 ataacaatgacaaaatcattgaaagccatctcttcaatgctcccccgttgcgtatcggtatcgaaagcatttggtcatcgacattgatcattaaaccata 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |    
33841480 ataacaatgacaaaatcattgaaagccatctcttcaatgctcccccgttgcgtatcgatatcgaaagcatttggtcatcgacattgatcattaaaccaaa 33841381  T
116 attggaaggtgttaattttcgcacggtattttaacgtatataccataaaaattaaactatgttctttgtgtgggatcggaaaacaaccattgactctgat 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||    
33841380 attggaaggtgttaattttcgcacggtattttaacgtatataccataaaaattaaactatgttttttgtgtgagatcggaaaacaaccattgactctgat 33841281  T
216 tgcatggcgaatatgtgaaaattc 239  Q
    ||||||||||||||||||||||||    
33841280 tgcatggcgaatatgtgaaaattc 33841257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University