View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18787_high_14 (Length: 241)
Name: NF18787_high_14
Description: NF18787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18787_high_14 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 14 - 241
Target Start/End: Original strand, 5982422 - 5982640
Alignment:
| Q |
14 |
aaaataacatgtttgattttggtaatcaacatgcacaaccacgaccggctgctggacaccaacacgcgcaaccaccaccgactgctggaaaccatcgcgc |
113 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5982422 |
aaaataacatgtttgattttcgtaatcaacatgcacaaccacgaccggctgctggacaccaacacgcgcaaccaccaccgactgctggaaaccatcgcgc |
5982521 |
T |
|
| Q |
114 |
acccccaccaccatttgctggatatcaacccggaccccaaccaccgtttgctggatatcgaccaccgccaccaggcccaccaccaatgtcagggtaccga |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5982522 |
acccccaccaccatttgctggatatcaacccggaccccaaccaccgtttgctggatatcgaccaccg---------ccaccaccaatgtcagggtaccga |
5982612 |
T |
|
| Q |
214 |
ccattctcaccaccaatgtcagggtatc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
5982613 |
ccattctcaccaccaatgtcagggtatc |
5982640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University