View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18787_low_1 (Length: 635)
Name: NF18787_low_1
Description: NF18787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18787_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 339; Significance: 0; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 18 - 411
Target Start/End: Complemental strand, 10358963 - 10358573
Alignment:
| Q |
18 |
aaaatcaaggttcatttcagcgaactgaaatagnnnnnnncaccacccacactctctctctagggttttagcattttgaaactgaaaaaacacatttttc |
117 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10358963 |
aaaatcaaggttcatttcaacaaactgaaatagaaaaaaacaccacccacactctctctctagggttttagcattttgaaactgaaaaaacacatttttc |
10358864 |
T |
 |
| Q |
118 |
tcattgcgatcatggcacctgctagggttttcggagcattcgccggcagaatgttaatggcggcggcggcgaaaggagcgacgaagaaggcggctacatc |
217 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10358863 |
tcatcgcgatcatggcaccagctagggttttcggagcattcgccggcagaatgttaatggcggcggcg---aaaggagcgacgaagaaggcggctacatc |
10358767 |
T |
 |
| Q |
218 |
cgccggagctgcatccacaaccgtcgtgaagaaaaccgcggtgaagaaaacggttacgagcaagggtaccggagggatacagaaggtagttcaggtcact |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10358766 |
cgccggagctgcatccacaaccgtcgtgaagaaaaccgcggtgaagaaaacggttacgagcaagagtaccggagggatacagaaggtagttcaggtcact |
10358667 |
T |
 |
| Q |
318 |
tctgagctcggtaatttcatcggtgcgcctgaagtttcgcggactgaagctgttaagaaagtttgggagtatatcaagctgcagaatcttcagg |
411 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10358666 |
tctgagctcggtaatttcatcggtgcgcctgaagtttcgcggactgaagctgttaagaaagtttgggagtatatcaagctgcagaatcttcagg |
10358573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 118; E-Value: 7e-60
Query Start/End: Original strand, 498 - 623
Target Start/End: Complemental strand, 10358486 - 10358361
Alignment:
| Q |
498 |
gatactgaatgaaaaactttgattaggttttatggattgattttgcgctatttgatttggttattgtttgttgtaatcgcattggtgtgttttagggata |
597 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10358486 |
gatactgaataaaaaactttgattaggttttatggattgattttgcgctatttgatttggttattgtttgttgtaatcgcattggtgtgttttagggata |
10358387 |
T |
 |
| Q |
598 |
ttttttgaatgttgtgatttgatatt |
623 |
Q |
| |
|
|||||||||| ||||||||||||||| |
|
|
| T |
10358386 |
ttttttgaatcttgtgatttgatatt |
10358361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University