View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18787_low_16 (Length: 255)
Name: NF18787_low_16
Description: NF18787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18787_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 5848141 - 5848371
Alignment:
| Q |
1 |
tgtgccaaaattgatacaacatggaggaataagaaatttgtcaagggtaatatacttatactaggttgttttgtagagcaaccgaaacatctaaagtatc |
100 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5848141 |
tgtgccaaaattgatacaatatagaggaataagaaatttgtcaagggtaatatacttatactaggttgttttgtagagcaaccgaaacatctaaagtatc |
5848240 |
T |
 |
| Q |
101 |
cccaagaaaaagggtaacatccatacactaggttggtttgcagagcaactgaaaaatctcaagcatgcccnnnnnnnnnnnnnnnngttacaatctttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5848241 |
cccaagaaaaagggtaacatccatacactaggttggtttgcagagcaactgaaaaatctcaagcatgcccaaaaataaaataaaaagttacaatctttgt |
5848340 |
T |
 |
| Q |
201 |
aatcaagtgaagcacattctaaagaagcaag |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5848341 |
aatcaagtgaagcacattctaaagaagcaag |
5848371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University