View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18787_low_18 (Length: 250)
Name: NF18787_low_18
Description: NF18787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18787_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 13 - 234
Target Start/End: Complemental strand, 35720683 - 35720451
Alignment:
| Q |
13 |
aatatactactttgttatttcactcnnnnnnnnagcgttgactatcaggttcgtaggggaataggtgttagtaatatgaagttcgg-cagtgatgtaaag |
111 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||| |||| |||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
35720683 |
aatatactactttgttatttcactcttttttttagcgttgactctcaggttcttaggtgaataggtgttagtaatatgaagttcgggcactgatgtaaag |
35720584 |
T |
 |
| Q |
112 |
atagtttgaccaaaaattgtt----------attaaactcagattcttttaaattattcttt-tttaaagaagttcattaaccatttgaacttaattgtt |
200 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||| ||||||||||||| ||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
35720583 |
atagtttgaccaagaattgtttcacccataaattaaactcagattcttctaaattattctttctttaaggaagttcattaaccatttgaactcaattgtt |
35720484 |
T |
 |
| Q |
201 |
tagtttatgacactccaacttttgttactaatag |
234 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
35720483 |
tagtttatgacactcc-acttttgttactaatag |
35720451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University