View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18788_high_7 (Length: 324)
Name: NF18788_high_7
Description: NF18788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18788_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 3e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 8020119 - 8019976
Alignment:
| Q |
1 |
tacttacattattgtgaagcttaaatctctttggatgttcttgttgtttttcagaaacatgacaactcatttcagtaacagcacttaagcttctaactta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8020119 |
tacttacattattgtgaagcttaaatctctttggatgttcttgttgtttttcagaaacatgacaactcatttcagtaacagcacttaagcttctaacttt |
8020020 |
T |
 |
| Q |
101 |
ttcttgcttctttggtttctttgagaattggaaagctatgtgtc |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8020019 |
ttcttgcttctttggtttctttgagaattggaaagctatgtgtc |
8019976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 224 - 311
Target Start/End: Complemental strand, 8019895 - 8019808
Alignment:
| Q |
224 |
cgacaaatgagttttgtttggtagctgagaaaaaacgagaatgagtttgtgatgtgtaagttgtttaccaccaaacaagagtttattt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8019895 |
cgacaaatgagttttgtttggtagctgagaaaaaacgagaatgagtttatgatgtgtaagttgtttaccaccaaacaagagtttattt |
8019808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University