View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18788_low_13 (Length: 291)
Name: NF18788_low_13
Description: NF18788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18788_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 171 - 273
Target Start/End: Original strand, 45774280 - 45774382
Alignment:
| Q |
171 |
taagggtggtacctgcgaacgctctaaccttgcatccattacaaacggcatccttcaatggttgggtctgatgattgatggaagggcgagcactgagtgt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45774280 |
taagggtggtacctgcgaacgctctaaccttgcatccattacaaacggcatccttcaatggttgggtctgatgattgatggaagggcgagcactgagtgt |
45774379 |
T |
 |
| Q |
271 |
atc |
273 |
Q |
| |
|
||| |
|
|
| T |
45774380 |
atc |
45774382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 10 - 116
Target Start/End: Original strand, 45774170 - 45774276
Alignment:
| Q |
10 |
attattcttgttttgttctctttcattctatttcttttagtactactaaattgtataataatgttttaatgtacattgagtagtaaaaaattagtaaaac |
109 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45774170 |
attattcttgttttgttctctttcaatctatttcttttagtactactaaattgtataataatgttttaatgtacattgagtagtcaaaaattagtaaaac |
45774269 |
T |
 |
| Q |
110 |
aatattc |
116 |
Q |
| |
|
||||||| |
|
|
| T |
45774270 |
aatattc |
45774276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University