View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18789_high_20 (Length: 201)
Name: NF18789_high_20
Description: NF18789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18789_high_20 |
 |  |
|
| [»] scaffold0086 (1 HSPs) |
 |  |  |
|
| [»] scaffold0014 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0086 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: scaffold0086
Description:
Target: scaffold0086; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 19 - 166
Target Start/End: Original strand, 30722 - 30870
Alignment:
| Q |
19 |
caaagcctgatggttggagtagtgcaattgaaaaatcttctctccactatttagtgtctatcaaaatctcaacataatgatcaaatagttgt-atcaaaa |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
30722 |
caaagcctgatggttggagtagtacaattgaaaaatcttctctccactatttagtgtctatcaaaatctcaacataatgattgaatagttgtcatcaaaa |
30821 |
T |
 |
| Q |
118 |
ttcaaaataaccaagtatataatgagaaatatcttacctagagtaactc |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30822 |
ttcaaaataaccaagtatataatgagaaatatcttacctagagtaactc |
30870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 50; Significance: 8e-20; HSPs: 3)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 103 - 180
Target Start/End: Original strand, 104226 - 104308
Alignment:
| Q |
103 |
atagttgt-atcaaaattcaaaataaccaagtatataatgagaaatatcttacctagagtaact----caatagacctctacc |
180 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
104226 |
atagttgtcatcaaaattcaaaataaccaattatataatgagaaatatgttacctagagtaactcttacaatagacctctacc |
104308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 103 - 163
Target Start/End: Complemental strand, 137885 - 137824
Alignment:
| Q |
103 |
atagttgt-atcaaaattcaaaataaccaagtatataatgagaaatatcttacctagagtaa |
163 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
137885 |
atagttgtcatcaaaattcaaaataaccaattatataatgagaaatatcttacctagagtaa |
137824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 43 - 86
Target Start/End: Complemental strand, 138856 - 138813
Alignment:
| Q |
43 |
caattgaaaaatcttctctccactatttagtgtctatcaaaatc |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
138856 |
caattgaaaaatcttctctccactatttagtgtctatcaaaatc |
138813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University