View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18789_high_3 (Length: 460)
Name: NF18789_high_3
Description: NF18789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18789_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 82 - 303
Target Start/End: Original strand, 35180797 - 35181018
Alignment:
| Q |
82 |
caaatgtgatgagggagcacttttgtaataatatatgttcaagagattacattttcttttctcttgcaaatgatttgatagcttccttacacgtgaacct |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35180797 |
caaatgtgatgagggagcacttttgtaataatatatgttcaagagattacattttcttttctcttgcaaatgatttgatagcttccttacacgtgaacct |
35180896 |
T |
 |
| Q |
182 |
gagtaaaactactgctcttcataattaatccaaagtagtactacttctttcaccaaaacaaaatttgnnnnnnnnnccttaacttcttttgtgatgcggt |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35180897 |
gagtaaaactactgctcttcataattaatccaaagtagtactacttctttcaccaaaacaaaatttgtttttttttccttaacttcttttgtgatgcggt |
35180996 |
T |
 |
| Q |
282 |
tcaagatattcaaagatttgca |
303 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35180997 |
tcaagatattcaaagatttgca |
35181018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 106; E-Value: 7e-53
Query Start/End: Original strand, 328 - 441
Target Start/End: Original strand, 35181018 - 35181131
Alignment:
| Q |
328 |
atctctagtatgcattccaaggtgagacatatatctcatgagaggaagggaactagaatcccgagtcatctttaaattcaatatccaagtacaacccaac |
427 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35181018 |
atctctagtatgcattccaaggtgagacatatatctcatgagaggaagggaactagaatcccaagtcatctttaaattcaatatccaagtacaatccaac |
35181117 |
T |
 |
| Q |
428 |
atagtatactcaat |
441 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
35181118 |
atagtatactcaat |
35181131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 279 - 417
Target Start/End: Original strand, 35183779 - 35183917
Alignment:
| Q |
279 |
ggttcaagatattcaaagatttgcaaatccgaggtatgactaattagtaatctctagtatgcattccaaggtgagacatatatctcatgagaggaaggga |
378 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
35183779 |
ggttcaagatattcaaagatttgcaaacccaaggtatgactaatttgtaatctctagtatgcactccaaggtgagacatatatctcattagaggaatgga |
35183878 |
T |
 |
| Q |
379 |
actagaatcccgagtcatctttaaattcaatatccaagt |
417 |
Q |
| |
|
| ||||||||| |||||||| || ||||||||||||||| |
|
|
| T |
35183879 |
attagaatcccaagtcatctctatattcaatatccaagt |
35183917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University